[CS] CS50 Week 6: Python

Key Points

Assignment: DNA

Main

Database

{‘name’: [‘AGATC’, ‘AATG’, ‘TATC’], 
‘Alice’: [‘2’, ‘8’, ‘3’],
‘Bob’: [‘4’, ‘1’, ‘5’],
‘Charlie’: [‘3’, ‘2’, ‘5’]}

DNA

AAGGTAAGTTTAGAATATAAAAGGTGAGTTAAATAGAATAGGTTAAAATTAAAGG0000TATCTATCTATCTATCTATCAGAAAAGAGTAAATAGTTAAAGAGTAAGATATTGAATTAATGGAAAATATTGTTGGGGAAAGGAGGGATAGAAGG

Compute The Repeated Time

A passionate  iOS developer. Write to record my learning and share the knowledge.

Get the Medium app

A button that says 'Download on the App Store', and if clicked it will lead you to the iOS App store
A button that says 'Get it on, Google Play', and if clicked it will lead you to the Google Play store